Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex

The DNA G-quadruplex is known for forming arange of topologies and for the observed lability of the assembly,consistent with its transient formation in live cells. The stabilizationof a particular topology by a small molecule is of great importancefor therapeutic applications. Here, we show that the rutheniumcomplex Lambda-[Ru(phen)2(qdppz)]2+displays enantiospecificG-quadruplex binding. It crystallized in 1:1 stoichiometry with amodified human telomeric G-quadruplex sequence,GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallelchair topology, thefirst structurally characterized example of ligandbinding to this topology. The lambda complex is bound in anintercalation cavity created by a terminal G-quartet and the centralnarrow lateral loop formed by T10-T11-A12. The two remainingwide lateral loops are linked through a third K+ion at the other end of the G-quartet stack, which also coordinates three thymineresidues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongestobserved inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Automated summary

The DNA G-quadruplex is a DNA structure with various topologies that forms transiently in live cells. This study demonstrates the enantiospecific binding of a ruthenium complex to G-quadruplex and highlights the importance of stabilizing a specific topology for therapeutic applications.