Journal
EUROPEAN JOURNAL OF PHARMACEUTICAL SCIENCES
Volume 156, Issue -, Pages -Publisher
ELSEVIER
DOI: 10.1016/j.ejps.2020.105572
Keywords
Aptamer; Molecular docking simulation; In silico maturation; Aptamer library
Categories
Funding
- CSIR [09/045(1706)2019 EMR-1]
- DST-Purse
- DST-SERB [EEQ/2016/000489]
- UGC
- DST-INSPIRE Faculty scheme [DST/INSPIRE/04/2017/001336]
Ask authors/readers for more resources
The study presents a high bio-recognizing DNA aptamer designed for diagnosis and therapeutic role against HHV-5, showing potent binding affinity to gB and potential regulatory role in virus blockade.
While the world is tackling one of the direst health emergencies, it has come to light that in the fight against viruses, preparedness is everything. A disease with the initial symptoms of the common flu has the capacity to disrupt the life of 7.8 billion people and thus no infection and especially no virus can be ignored. Hence, we have designed the high bio-recognizing DNA aptamer for diagnosis and therapeutics role against glycoprotein-B (gB) of Human Herpes Virus-5 (HHV-5). HHV-5 is linked with epidemiological and asymptomatic diseases leading to high mortality. Herein, we report potent aptamer (5'CTCGCTTACCCCTGGGTGTGCGGG3') which has high specificity to gB with energy score -523.28 kJ/mol, more than reference aptamer L19 (-363.50 kJ/mol). The stable binding of aptamer with gB was confirmed with atomic fluctuations 0.1 to 1.8 angstrom through anisotropic network analysis. Aptamer formed stem-loop conformation (-1.0 kcal/mol) by stochastic simulation and found stable with physicochemical properties. Importantly, aptamer was found biologically significant with consisting of putative transcription factors in its vicinity (SP1, GATA1, AP2, NF1) and also possesses homology with exonic sequence of SGSH gene which indicated regulatory role in blockade of viruses. In addition, we also proposed plausible mechanism of action of aptamer as antiviral therapeutics.
Authors
I am an author on this paper
Click your name to claim this paper and add it to your profile.
Reviews
Recommended
No Data Available